| Accession | MI0001219 | ||||
| Name | gga-mir-181b-1 | ||||
| similar to following miRCarta precursors | gga-25787-26531.1 | ||||
| Organism | Gallus gallus | ||||
| Genome | Gallus-gallus-4.0 | ||||
| Location |
chr8:1,986,876-1,986,964 (+) |
||||
| miRNA | gga-miR-181b-5p | ||||
| miRNA | gga-miR-181b-1-3p | ||||
| Sequence (5' -> 3') (89 nts) |
AAAAGGUCACAAUCAACAUUCAUUGCUGUCGGUGGGUUUAACUAUGUGGACAAGCUCACUGAACAAUGAAUGCAACUGUGGCCCCACAU | ||||
| MFE | -33.20 kcal/mol | ||||
| first miRBase version | 4.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
gga-mir-181a-1
gga-mir-181b-1 |
||||
| Family | mir-181 (MIPF0000007) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Hillier et al. | Nature | 2004 | 15592404 | Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. |
| 2 | Yao et al. | J. Virol. | 2008 | 18256158 | MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs. |
| 3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |