Precursor miRBase

gga-mir-103-2 (MI0001213)

Accession MI0001213
Name gga-mir-103-2
similar to following miRCarta precursors gga-26430-12.1
Organism Gallus gallus
Genome Gallus-gallus-4.0
Location chr4:88,047,783-88,047,865 (-)
miRNA gga-miR-103-2-5p
miRNA gga-miR-103-3p
Sequence (5' -> 3')
(83 nts)
UCUCUGUGCUUUCAGCUUCUUUACAGUGCUGCCUUGUUGCGUUCAUGUCAAGCAGCAUUGUACAGGGCUAUGAAAGAACAGAG
MFE -35.60 kcal/mol
first miRBase version 4.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
gga-mir-103-2
Family mir-103 (MIPF0000024)
Experiments
experiment Pubmed link
Illumina 23034410

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Hillier et al. Nature 2004 15592404 Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution.
2 Meunier et al. Genome Res. 2013 23034410 Birth and expression evolution of mammalian microRNA genes.