Precursor miRBase

gga-mir-30a (MI0001204)

Accession MI0001204
Name gga-mir-30a
similar to following miRCarta precursors gga-15-38.1
Organism Gallus gallus
Genome Gallus-gallus-4.0
Location chr3:81,754,485-81,754,556 (+)
miRNA gga-miR-30a-5p
miRNA gga-miR-30a-3p
Sequence (5' -> 3')
(72 nts)
GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCAGCAGAUGGGGCUUUCAGUCGGAUGUUUGCAGCUGC
MFE -35.60 kcal/mol
first miRBase version 4.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
gga-mir-30a
Family mir-30 (MIPF0000005)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Hillier et al. Nature 2004 15592404 Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution.
2 Yao et al. J. Virol. 2008 18256158 MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs.