Precursor miRBase

gga-mir-26a (MI0001187)

Accession MI0001187
Name gga-mir-26a
similar to following miRCarta precursors gga-26214-26213.1
Organism Gallus gallus
Genome Gallus-gallus-4.0
Location chr2:4,537,766-4,537,842 (+)
miRNA gga-miR-26a-5p
miRNA gga-miR-26a-3p
Sequence (5' -> 3')
(77 nts)
GUCACCUGGUUCAAGUAAUCCAGGAUAGGCUGUAUCCAUUCCUGCUGGCCUAUUCUUGGUUACUUGCACUGGGAGGC
MFE -36.60 kcal/mol
first miRBase version 4.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
gga-mir-26a
Family mir-26 (MIPF0000043)
Experiments
experiment Pubmed link
Illumina 23034410

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Hillier et al. Nature 2004 15592404 Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution.
2 Yao et al. J. Virol. 2008 18256158 MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs.
3 Meunier et al. Genome Res. 2013 23034410 Birth and expression evolution of mammalian microRNA genes.