| Accession | MI0001173 | ||||
| Name | gga-mir-99a | ||||
| similar to following miRCarta precursors | gga-26146-396.1 | ||||
| Organism | Gallus gallus | ||||
| Genome | Gallus-gallus-4.0 | ||||
| Location |
chr1:98,347,473-98,347,553 (+) |
||||
| miRNA | gga-miR-99a-5p | ||||
| miRNA | gga-miR-99a-3p | ||||
| Sequence (5' -> 3') (81 nts) |
CCAAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGUUGAAAUGCACUGCACAAGCUCGCUUCUAUGGGUCUGUGUCAGUAUG | ||||
| MFE | -37.60 kcal/mol | ||||
| first miRBase version | 4.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
gga-mir-99a gga-let-7c |
||||
| Family | mir-10 (MIPF0000033) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Hillier et al. | Nature | 2004 | 15592404 | Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. |
| 2 | Shao et al. | Gene | 2008 | 18511220 | Identification of novel chicken microRNAs and analysis of their genomic organization. |