Precursor miRBase

gga-mir-29b-2 (MI0001266)

Accession MI0001266
Name gga-mir-29b-2
similar to following miRCarta precursors gga-26874-26873.1
Organism Gallus gallus
Genome Gallus-gallus-4.0
Location chr26:2,641,616-2,641,695 (-)
miRNA gga-miR-29b-2-5p
miRNA gga-miR-29b-3p
Sequence (5' -> 3')
(80 nts)
CCUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUCCCACUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUCUAGGAG
MFE -31.00 kcal/mol
first miRBase version 4.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
gga-mir-29c
gga-mir-29b-2
Family mir-29 (MIPF0000009)
Experiments
experiment Pubmed link
Illumina 23034410

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Hillier et al. Nature 2004 15592404 Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution.
2 Yao et al. J. Virol. 2008 18256158 MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs.
3 Meunier et al. Genome Res. 2013 23034410 Birth and expression evolution of mammalian microRNA genes.