| Accession | MI0001151 | ||||||
| Name | mmu-mir-196b | ||||||
| similar to following miRCarta precursors | mmu-146-1143.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr6:52,230,081-52,230,165 (-) |
||||||
| miRNA | mmu-miR-196b-5p | ||||||
| miRNA | mmu-miR-196b-3p | ||||||
| Sequence (5' -> 3') (85 nts) |
AACUGGUCGGUGAUUUAGGUAGUUUCCUGUUGUUGGGAUCCACCUUUCUCUCGACAGCACGACACUGCCUUCAUUACUUCAGUUG | ||||||
| MFE | -35.50 kcal/mol | ||||||
| first miRBase version | 4.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
mmu-mir-196b |
||||||
| Family | mir-196 (MIPF0000031) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Yekta et al. | Science | 2004 | 15105502 | MicroRNA-directed cleavage of HOXB8 mRNA. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Zhu et al. | J. Virol. | 2010 | 20668074 | Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68. |
| 4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |