Precursor miRBase

hsa-mir-345 (MI0000825)

Accession MI0000825
Name hsa-mir-345
similar to following miRCarta precursors hsa-193-717.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr14:100,307,859-100,307,956 (+)
miRNA hsa-miR-345-5p
miRNA hsa-miR-345-3p
Sequence (5' -> 3')
(98 nts)
ACCCAAACCCUAGGUCUGCUGACUCCUAGUCCAGGGCUCGUGAUGGCUGGUGGGCCCUGAACGAGGGGUCUGGAGGCCUGGGUUUGAAUAUCGACAGC
MFE -49.80 kcal/mol
first miRBase version 4.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
hsa-mir-345
Family mir-345 (MIPF0000189)
External DBs
Gene symbol MIR345
NCBI Gene 442910

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
2 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
3 Fu et al. FEBS Lett. 2005 15978578 Identification of human fetal liver miRNAs by a novel method.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.