| Accession | MI0000782 | ||||
| Name | hsa-mir-374a | ||||
| similar to following miRCarta precursors | hsa-184-74.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:74,287,286-74,287,357 (-) |
||||
| miRNA | hsa-miR-374a-5p | ||||
| miRNA | hsa-miR-374a-3p | ||||
| Sequence (5' -> 3') (72 nts) |
UACAUCGGCCAUUAUAAUACAACCUGAUAAGUGUUAUAGCACUUAUCAGAUUGUAUUGUAAUUGUCUGUGUA | ||||
| MFE | -34.50 kcal/mol | ||||
| first miRBase version | 4.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-545
hsa-mir-374a |
||||
| Family | mir-374 (MIPF0000288) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Suh et al. | Dev. Biol. | 2004 | 15183728 | Human embryonic stem cells express a unique set of microRNAs. |
| 2 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 3 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |