| Accession | MI0000775 | ||||
| Name | hsa-mir-367 | ||||
| similar to following miRCarta precursors | hsa-1286-858.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr4:112,647,874-112,647,941 (-) |
||||
| miRNA | hsa-miR-367-5p | ||||
| miRNA | hsa-miR-367-3p | ||||
| Sequence (5' -> 3') (68 nts) |
CCAUUACUGUUGCUAAUAUGCAACUCUGUUGAAUAUAAAUUGGAAUUGCACUUUAGCAAUGGUGAUGG | ||||
| MFE | -28.60 kcal/mol | ||||
| first miRBase version | 4.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (5 precursors) |
hsa-mir-367 hsa-mir-302d hsa-mir-302a hsa-mir-302c hsa-mir-302b |
||||
| Family | mir-367 (MIPF0000162) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Suh et al. | Dev. Biol. | 2004 | 15183728 | Human embryonic stem cells express a unique set of microRNAs. |
| 2 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |