Accession | MI0000953 | ||||||
Name | rno-mir-181a-1 | ||||||
similar to following miRCarta precursors | rno-32-125.1 | ||||||
Organism | Rattus norvegicus | ||||||
Genome | Rnor_5.0 | ||||||
Location |
chr13:59,986,075-59,986,174 (+) |
||||||
miRNA | rno-miR-181a-5p | ||||||
miRNA | rno-miR-181a-1-3p | ||||||
Sequence (5' -> 3') (100 nts) |
AGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGAAUUCAAAUAAAAACCAUCGACCGUUGAUUGUACCCUAUAGCUAACCAUUAUCUACUCC | ||||||
MFE | -29.70 kcal/mol | ||||||
first miRBase version | 3.1 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (3 precursors) |
rno-mir-3570
rno-mir-181a-1 rno-mir-181b-1 |
||||||
Family | mir-181 (MIPF0000007) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Miska et al. | Genome Biol. | 2004 | 15345052 | Microarray analysis of microRNA expression in the developing mammalian brain. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | He et al. | Acta Biochim. Biophys. Sin. (Shanghai) | 2007 | 17805466 | Cloning and identification of novel microRNAs from rat hippocampus. |
4 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |