Precursor miRBase

rno-mir-191a (MI0000934)

Accession MI0000934
Name rno-mir-191a
similar to following miRCarta precursors rno-48-24946.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr8:116,698,867-116,698,957 (+)
miRNA rno-miR-191a-5p
miRNA rno-miR-191a-3p
Sequence (5' -> 3')
(91 nts)
GGCUGGACAGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUCUCCAGAGCAUUCCAGCUGCACUUGGAUUUCGUUCCCUGCUCUCCUGCCU
MFE -46.80 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(3 precursors)
rno-mir-191b
rno-mir-191a
rno-mir-425
Family mir-191 (MIPF0000194)
Experiments
experiment Pubmed link
SOLiD 20403161
External DBs
Gene symbol Mir191
NCBI Gene 100314045

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Miska et al. Genome Biol. 2004 15345052 Microarray analysis of microRNA expression in the developing mammalian brain.
2 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
3 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.