| Accession | MI0000920 | ||||
| Name | rno-mir-150 | ||||
| similar to following miRCarta precursors | rno-94-498.1 | ||||
| Organism | Rattus norvegicus | ||||
| Genome | Rnor_5.0 | ||||
| Location |
chr1:102,181,484-102,181,568 (+) |
||||
| miRNA | rno-miR-150-5p | ||||
| miRNA | rno-miR-150-3p | ||||
| Sequence (5' -> 3') (85 nts) |
CUUCUCAAGGCCCUGUCUCCCAACCCUUGUACCAGUGCUGUGCCUCAGACCCUGGUACAGGCCUGGGGGACAGGGACUUGGGGAC | ||||
| MFE | -51.60 kcal/mol | ||||
| first miRBase version | 3.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
rno-mir-150 |
||||
| Family | mir-150 (MIPF0000197) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Miska et al. | Genome Biol. | 2004 | 15345052 | Microarray analysis of microRNA expression in the developing mammalian brain. |
| 2 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |