| Accession | MI0000904 | ||||
| Name | rno-mir-130b | ||||
| similar to following miRCarta precursors | rno-25429-29611.1 | ||||
| Organism | Rattus norvegicus | ||||
| Genome | Rnor_5.0 | ||||
| Location |
chr11:91,182,320-91,182,401 (+) |
||||
| miRNA | rno-miR-130b-5p | ||||
| miRNA | rno-miR-130b-3p | ||||
| Sequence (5' -> 3') (82 nts) |
GGCUUGCUGGACACUCUUUCCCUGUUGCACUACUGUGGGCCUCUGGGAAGCAGUGCAAUGAUGAAAGGGCAUCCGUCAGGCC | ||||
| MFE | -33.40 kcal/mol | ||||
| first miRBase version | 3.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
rno-mir-301b
rno-mir-130b |
||||
| Family | mir-130 (MIPF0000034) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Kim et al. | Proc. Natl. Acad. Sci. U.S.A. | 2004 | 14691248 | Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. |
| 2 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |