Accession | MI0000889 | ||||||
Name | rno-mir-106b | ||||||
similar to following miRCarta precursors | rno-103-87.1 | ||||||
Organism | Rattus norvegicus | ||||||
Genome | Rnor_5.0 | ||||||
Location |
chr12:21,365,382-21,365,463 (-) |
||||||
miRNA | rno-miR-106b-5p | ||||||
miRNA | rno-miR-106b-3p | ||||||
Sequence (5' -> 3') (82 nts) |
CCUGCUGGGACUAAAGUGCUGACAGUGCAGAUAGUGGUCCUCUCUGUGCUACCGCACUGUGGGUACUUGCUGCUCCAGCAGG | ||||||
MFE | -39.40 kcal/mol | ||||||
first miRBase version | 3.1 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (3 precursors) |
rno-mir-25
rno-mir-93 rno-mir-106b |
||||||
Family | mir-17 (MIPF0000001) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |