Precursor miRBase

rno-mir-103-1 (MI0000888)

Accession MI0000888
Name rno-mir-103-1
similar to following miRCarta precursors rno-2698-13.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr10:20,480,351-20,480,436 (+)
miRNA rno-miR-103-1-5p
miRNA rno-miR-103-3p
Sequence (5' -> 3')
(86 nts)
UUCUUACUGCCCUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUACAGGGCUAUGAAGGCAUUGAGAC
MFE -34.20 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
rno-mir-103-1
Family mir-103 (MIPF0000024)
Experiments
experiment Pubmed link
SOLiD 20403161
External DBs
Gene symbol Mir103a1
NCBI Gene 100314021

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Miska et al. Genome Biol. 2004 15345052 Microarray analysis of microRNA expression in the developing mammalian brain.
2 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
3 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.