| Accession | MI0000884 | ||||||
| Name | rno-mir-99b | ||||||
| similar to following miRCarta precursors | rno-10-151.1 | ||||||
| Organism | Rattus norvegicus | ||||||
| Genome | Rnor_5.0 | ||||||
| Location |
chr1:60,623,874-60,623,943 (+) |
||||||
| miRNA | rno-miR-99b-5p | ||||||
| miRNA | rno-miR-99b-3p | ||||||
| Sequence (5' -> 3') (70 nts) |
GGCACCCACCCGUAGAACCGACCUUGCGGGGCCUUCGCCGCACACAAGCUCGUGUCUGUGGGUCCGUGUC | ||||||
| MFE | -27.60 kcal/mol | ||||||
| first miRBase version | 3.1 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (4 precursors) |
rno-mir-99b rno-mir-3596c rno-let-7e rno-mir-125a |
||||||
| Family | mir-10 (MIPF0000033) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Miska et al. | Genome Biol. | 2004 | 15345052 | Microarray analysis of microRNA expression in the developing mammalian brain. |
| 2 | Kim et al. | Proc. Natl. Acad. Sci. U.S.A. | 2004 | 14691248 | Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. |
| 3 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |