Precursor miRBase

rno-mir-32 (MI0000873)

Accession MI0000873
Name rno-mir-32
similar to following miRCarta precursors rno-208-29514.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr5:78,089,043-78,089,112 (-)
miRNA rno-miR-32-5p
miRNA rno-miR-32-3p
Sequence (5' -> 3')
(70 nts)
GGGGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUCUC
MFE -31.70 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
rno-mir-32
Family mir-32 (MIPF0000069)
Experiments
experiment Pubmed link
SOLiD 20403161
External DBs
Gene symbol Mir32
NCBI Gene 100314013

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
2 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
3 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.