Precursor miRBase

rno-mir-30e (MI0000867)

Accession MI0000867
Name rno-mir-30e
similar to following miRCarta precursors rno-24-25.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr5:143,497,752-143,497,843 (-)
miRNA rno-miR-30e-5p
miRNA rno-miR-30e-3p
Sequence (5' -> 3')
(92 nts)
GGGCAGUCUUUGCUACUGUAAACAUCCUUGACUGGAAGCUGUAAGGUGUUGAGAGGAGCUUUCAGUCGGAUGUUUACAGCGGCAGGCUGCCA
MFE -51.80 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
rno-mir-30c-1
rno-mir-30e
Family mir-30 (MIPF0000005)
Experiments
experiment Pubmed link
cloned 17604727
SOLiD 20403161
External DBs
Gene symbol Mir30e
NCBI Gene 100314153

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
2 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
3 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.