| Accession | MI0000862 | ||||||
| Name | rno-mir-29b-2 | ||||||
| similar to following miRCarta precursors | rno-239-81.1 rno-239-81.2 | ||||||
| Organism | Rattus norvegicus | ||||||
| Genome | Rnor_5.0 | ||||||
| Location |
chr1:39,612,388-39,612,468 (+) |
||||||
| miRNA | rno-miR-29b-5p | ||||||
| miRNA | rno-miR-29b-3p | ||||||
| Sequence (5' -> 3') (81 nts) |
CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG | ||||||
| MFE | -31.10 kcal/mol | ||||||
| first miRBase version | 3.1 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (3 precursors) |
rno-mir-29b-2 rno-mir-3556b-1 rno-mir-29c-1 |
||||||
| Family | mir-29 (MIPF0000009) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Miska et al. | Genome Biol. | 2004 | 15345052 | Microarray analysis of microRNA expression in the developing mammalian brain. |
| 2 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | He et al. | Acta Biochim. Biophys. Sin. (Shanghai) | 2007 | 17805466 | Cloning and identification of novel microRNAs from rat hippocampus. |
| 5 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |