Precursor miRBase

rno-mir-27b (MI0000859)

Accession MI0000859
Name rno-mir-27b
similar to following miRCarta precursors rno-240-39.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr17:816,274-816,370 (+)
miRNA rno-miR-27b-5p
miRNA rno-miR-27b-3p
Sequence (5' -> 3')
(97 nts)
ACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCGCUUUGUUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUG
MFE -49.40 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(4 precursors)
rno-mir-23b
rno-mir-27b
rno-mir-3074
rno-mir-24-1
Family mir-27 (MIPF0000036)
Experiments
experiment Pubmed link
SOLiD 20403161
External DBs
Gene symbol Mir27b
NCBI Gene 100314005

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
2 He et al. Acta Biochim. Biophys. Sin. (Shanghai) 2007 17805466 Cloning and identification of novel microRNAs from rat hippocampus.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.