| Accession | MI0000859 | ||||
| Name | rno-mir-27b | ||||
| similar to following miRCarta precursors | rno-240-39.1 | ||||
| Organism | Rattus norvegicus | ||||
| Genome | Rnor_5.0 | ||||
| Location |
chr17:816,274-816,370 (+) |
||||
| miRNA | rno-miR-27b-5p | ||||
| miRNA | rno-miR-27b-3p | ||||
| Sequence (5' -> 3') (97 nts) |
ACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCGCUUUGUUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUG | ||||
| MFE | -49.40 kcal/mol | ||||
| first miRBase version | 3.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (4 precursors) |
rno-mir-23b
rno-mir-27b rno-mir-3074 rno-mir-24-1 |
||||
| Family | mir-27 (MIPF0000036) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | He et al. | Acta Biochim. Biophys. Sin. (Shanghai) | 2007 | 17805466 | Cloning and identification of novel microRNAs from rat hippocampus. |
| 4 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |