Accession | MI0000858 | ||||||
Name | rno-mir-26b | ||||||
similar to following miRCarta precursors | rno-53-218.1 | ||||||
Organism | Rattus norvegicus | ||||||
Genome | Rnor_5.0 | ||||||
Location |
chr9:81,439,824-81,439,908 (+) |
||||||
miRNA | rno-miR-26b-5p | ||||||
miRNA | rno-miR-26b-3p | ||||||
Sequence (5' -> 3') (85 nts) |
UGCCCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGGUGCUGGCCAGCCUGUUCUCCAUUACUUGGCUCGGGGGCCGGUGCC | ||||||
MFE | -43.40 kcal/mol | ||||||
first miRBase version | 3.1 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (1 precursors) |
rno-mir-26b |
||||||
Family | mir-26 (MIPF0000043) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Miska et al. | Genome Biol. | 2004 | 15345052 | Microarray analysis of microRNA expression in the developing mammalian brain. |
2 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |