| Accession | MI0000854 | ||||||||
| Name | rno-mir-24-1 | ||||||||
| similar to following miRCarta precursors | rno-283-35.1 | ||||||||
| Organism | Rattus norvegicus | ||||||||
| Genome | Rnor_5.0 | ||||||||
| Location |
chr17:816,781-816,848 (+) |
||||||||
| miRNA | rno-miR-24-1-5p | ||||||||
| miRNA | rno-miR-24-3p | ||||||||
| Sequence (5' -> 3') (68 nts) |
CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUCACACACUGGCUCAGUUCAGCAGGAACAGGAG | ||||||||
| MFE | -26.30 kcal/mol | ||||||||
| first miRBase version | 3.1 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (4 precursors) |
rno-mir-23b
rno-mir-27b rno-mir-3074 rno-mir-24-1 |
||||||||
| Family | mir-24 (MIPF0000041) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Miska et al. | Genome Biol. | 2004 | 15345052 | Microarray analysis of microRNA expression in the developing mammalian brain. |
| 2 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | He et al. | Acta Biochim. Biophys. Sin. (Shanghai) | 2007 | 17805466 | Cloning and identification of novel microRNAs from rat hippocampus. |
| 5 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |