Precursor miRBase

rno-mir-22 (MI0000851)

Accession MI0000851
Name rno-mir-22
similar to following miRCarta precursors rno-217-2.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr10:62,013,642-62,013,736 (+)
miRNA rno-miR-22-5p
miRNA rno-miR-22-3p
Sequence (5' -> 3')
(95 nts)
ACCUGGCUGAGCCGCAGUAGUUCUUCAGUGGCAAGCUUUAUGUCCUGACCCAGCUAAAGCUGCCAGUUGAAGAACUGUUGCCCUCUGCCACUGGC
MFE -43.00 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
rno-mir-6326
rno-mir-22
Family mir-22 (MIPF0000053)
Experiments
experiment Pubmed link
cloned 16766679 17604727
SOLiD 20403161
External DBs
Gene symbol Mir22
NCBI Gene 100314001

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
2 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
3 He et al. Acta Biochim. Biophys. Sin. (Shanghai) 2007 17805466 Cloning and identification of novel microRNAs from rat hippocampus.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.