Precursor miRBase

rno-mir-21 (MI0000850)

Accession MI0000850
Name rno-mir-21
similar to following miRCarta precursors rno-1-25100.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr10:76,197,081-76,197,172 (+)
miRNA rno-miR-21-5p
miRNA rno-miR-21-3p
Sequence (5' -> 3')
(92 nts)
UGUACCACCUUGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACAGCAGUCGAUGGGCUGUCUGACAUUUUGGUAUC
MFE -42.60 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
rno-mir-21
Family mir-21 (MIPF0000060)
Experiments
experiment Pubmed link
cloned 17604727
SOLiD 20403161
External DBs
Gene symbol Mir21
NCBI Gene 100314000

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
2 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 He et al. Acta Biochim. Biophys. Sin. (Shanghai) 2007 17805466 Cloning and identification of novel microRNAs from rat hippocampus.
5 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.