| Accession | MI0000848 | ||||
| Name | rno-mir-19b-2 | ||||
| similar to following miRCarta precursors | rno-25639-121.1 | ||||
| Organism | Rattus norvegicus | ||||
| Genome | Rnor_5.0 | ||||
| Location |
chrX:140,167,226-140,167,321 (-) |
||||
| miRNA | rno-miR-19b-2-5p | ||||
| miRNA | rno-miR-19b-3p | ||||
| Sequence (5' -> 3') (96 nts) |
ACAUUGCUACUUACGGUUAGUUUUGCAGAUUUGCAGUUCAGCGUAUAUGUGGAUAUAUGGCUGUGCAAAUCCAUGCAAAACUGAUUGUGAUGAUGU | ||||
| MFE | -39.20 kcal/mol | ||||
| first miRBase version | 3.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (5 precursors) |
rno-mir-363
rno-mir-92a-2 rno-mir-19b-2 rno-mir-20b rno-mir-17-2 |
||||
| Family | mir-19 (MIPF0000011) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Kim et al. | Proc. Natl. Acad. Sci. U.S.A. | 2004 | 14691248 | Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. |
| 2 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |