| Accession | MI0000846 | ||||
| Name | rno-mir-18a | ||||
| similar to following miRCarta precursors | rno-262-389.1 | ||||
| Organism | Rattus norvegicus | ||||
| Genome | Rnor_5.0 | ||||
| Location |
chr15:103,641,038-103,641,133 (+) |
||||
| miRNA | rno-miR-18a-5p | ||||
| miRNA | rno-miR-18a-3p | ||||
| Sequence (5' -> 3') (96 nts) |
UGCGUGCUUUUUGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGACUAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCAUAAGAAGUUAUGUC | ||||
| MFE | -29.20 kcal/mol | ||||
| first miRBase version | 3.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
rno-mir-17-1
rno-mir-18a rno-mir-19a rno-mir-20a rno-mir-19b-1 rno-mir-92a-1 |
||||
| Family | mir-17 (MIPF0000001) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Kim et al. | Proc. Natl. Acad. Sci. U.S.A. | 2004 | 14691248 | Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |