Precursor miRBase

rno-mir-9a-2 (MI0000840)

Accession MI0000840
Name rno-mir-9a-2
similar to following miRCarta precursors rno-104-578.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr2:11,746,822-11,746,908 (+)
miRNA rno-miR-9a-5p
miRNA rno-miR-9a-3p
Sequence (5' -> 3')
(87 nts)
GGAAGCGAGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUAUUGGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAACUCCUUCA
MFE -38.90 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
rno-mir-9b-2
rno-mir-9a-2
Family mir-9 (MIPF0000014)
Experiments
experiment Pubmed link
cloned 17604727
SOLiD 20403161
External DBs
Gene symbol Mir9-2
NCBI Gene 100313995

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
2 Miska et al. Genome Biol. 2004 15345052 Microarray analysis of microRNA expression in the developing mammalian brain.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 He et al. Acta Biochim. Biophys. Sin. (Shanghai) 2007 17805466 Cloning and identification of novel microRNAs from rat hippocampus.
5 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.