Precursor miRBase

rno-let-7c-1 (MI0000830)

Accession MI0000830
Name rno-let-7c-1
similar to following miRCarta precursors rno-37-324.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr11:19,708,143-19,708,236 (+)
miRNA rno-let-7c-5p
miRNA rno-let-7c-1-3p
Sequence (5' -> 3')
(94 nts)
UGUGUGCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGCACACU
MFE -41.20 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
rno-mir-99a
rno-let-7c-1
Family let-7 (MIPF0000002)
Experiments
experiment Pubmed link
SOLiD 20403161
External DBs
Gene symbol Mirlet7c-1
NCBI Gene 100314184

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Miska et al. Genome Biol. 2004 15345052 Microarray analysis of microRNA expression in the developing mammalian brain.
2 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
3 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 He et al. Acta Biochim. Biophys. Sin. (Shanghai) 2007 17805466 Cloning and identification of novel microRNAs from rat hippocampus.
6 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.