Accession | MI0000821 | ||||
Name | mmu-mir-133b | ||||
similar to following miRCarta precursors | mmu-24151-629.1 | ||||
Organism | Mus musculus | ||||
Genome | GRCm38.p5 | ||||
Location |
chr1:20,682,769-20,682,887 (+) |
||||
miRNA | mmu-miR-133b-5p | ||||
miRNA | mmu-miR-133b-3p | ||||
Sequence (5' -> 3') (119 nts) |
CCUCCAAAGGGAGUGGCCCCCUGCUCUGGCUGGUCAAACGGAACCAAGUCCGUCUUCCUGAGAGGUUUGGUCCCCUUCAACCAGCUACAGCAGGGCUGGCAAAGCUCAAUAUUUGGAGA | ||||
MFE | -58.80 kcal/mol | ||||
first miRBase version | 3.1 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
mmu-mir-206
mmu-mir-133b |
||||
Family | mir-133 (MIPF0000029) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Lim et al. | Science | 2003 | 12624257 | Vertebrate microRNA genes. |
2 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |