Precursor miRBase

hsa-mir-135b (MI0000810)

Accession MI0000810
Name hsa-mir-135b
similar to following miRCarta precursors hsa-321-831.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr1:205,448,302-205,448,398 (-)
miRNA hsa-miR-135b-5p
miRNA hsa-miR-135b-3p
Sequence (5' -> 3')
(97 nts)
CACUCUGCUGUGGCCUAUGGCUUUUCAUUCCUAUGUGAUUGCUGUCCCAAACUCAUGUAGGGCUAAAAGCCAUGGGCUACAGUGAGGGGCGAGCUCC
MFE -46.70 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
hsa-mir-135b
Family mir-135 (MIPF0000028)
Experiments
experiment Pubmed link
cloned 17604727
External DBs
Gene symbol MIR135B
NCBI Gene 442891

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
2 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
3 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.