Accession | MI0000805 | ||||||
Name | hsa-mir-342 | ||||||
similar to following miRCarta precursors | hsa-281-128.1 | ||||||
Organism | Homo sapiens | ||||||
Genome | GRCh38.p10 | ||||||
Location |
chr14:100,109,655-100,109,753 (+) |
||||||
miRNA | hsa-miR-342-5p | ||||||
miRNA | hsa-miR-342-3p | ||||||
Sequence (5' -> 3') (99 nts) |
GAAACUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGACAUGGUUAAUGGAAUUGUCUCACACAGAAAUCGCACCCGUCACCUUGGCCUACUUA | ||||||
MFE | -47.70 kcal/mol | ||||||
first miRBase version | 3.1 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (2 precursors) |
hsa-mir-151b
hsa-mir-342 |
||||||
Family | mir-342 (MIPF0000190) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Kim et al. | Proc. Natl. Acad. Sci. U.S.A. | 2004 | 14691248 | Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. |
2 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
5 | Afanasyeva et al. | BMC Genomics | 2008 | 18230126 | New miRNAs cloned from neuroblastoma. |