Precursor miRBase

hsa-mir-342 (MI0000805)

Accession MI0000805
Name hsa-mir-342
similar to following miRCarta precursors hsa-281-128.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr14:100,109,655-100,109,753 (+)
miRNA hsa-miR-342-5p
miRNA hsa-miR-342-3p
Sequence (5' -> 3')
(99 nts)
GAAACUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGACAUGGUUAAUGGAAUUGUCUCACACAGAAAUCGCACCCGUCACCUUGGCCUACUUA
MFE -47.70 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-151b
hsa-mir-342
Family mir-342 (MIPF0000190)
Experiments
experiment Pubmed link
cloned 17604727 17616659 18230126
Northern blot 18230126
External DBs
Gene symbol MIR342
NCBI Gene 442909

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
2 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
3 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Afanasyeva et al. BMC Genomics 2008 18230126 New miRNAs cloned from neuroblastoma.