Accession | MI0000803 | ||||
Name | hsa-mir-330 | ||||
similar to following miRCarta precursors | hsa-200-347.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr19:45,638,994-45,639,087 (-) |
||||
miRNA | hsa-miR-330-5p | ||||
miRNA | hsa-miR-330-3p | ||||
Sequence (5' -> 3') (94 nts) |
CUUUGGCGAUCACUGCCUCUCUGGGCCUGUGUCUUAGGCUCUGCAAGAUCAACCGAGCAAAGCACACGGCCUGCAGAGAGGCAGCGCUCUGCCC | ||||
MFE | -45.00 kcal/mol | ||||
first miRBase version | 3.1 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
hsa-mir-330 |
||||
Family | mir-330 (MIPF0000200) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Kim et al. | Proc. Natl. Acad. Sci. U.S.A. | 2004 | 14691248 | Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. |
2 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |