Precursor miRBase

hsa-mir-330 (MI0000803)

Accession MI0000803
Name hsa-mir-330
similar to following miRCarta precursors hsa-200-347.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr19:45,638,994-45,639,087 (-)
miRNA hsa-miR-330-5p
miRNA hsa-miR-330-3p
Sequence (5' -> 3')
(94 nts)
CUUUGGCGAUCACUGCCUCUCUGGGCCUGUGUCUUAGGCUCUGCAAGAUCAACCGAGCAAAGCACACGGCCUGCAGAGAGGCAGCGCUCUGCCC
MFE -45.00 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
hsa-mir-330
Family mir-330 (MIPF0000200)
Experiments
experiment Pubmed link
cloned 17604727 17616659
External DBs
Gene symbol MIR330
NCBI Gene 442902

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
2 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.