| Accession | MI0000749 | ||||
| Name | hsa-mir-30e | ||||
| similar to following miRCarta precursors | hsa-24-25.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr1:40,754,355-40,754,446 (+) |
||||
| miRNA | hsa-miR-30e-5p | ||||
| miRNA | hsa-miR-30e-3p | ||||
| Sequence (5' -> 3') (92 nts) |
GGGCAGUCUUUGCUACUGUAAACAUCCUUGACUGGAAGCUGUAAGGUGUUCAGAGGAGCUUUCAGUCGGAUGUUUACAGCGGCAGGCUGCCA | ||||
| MFE | -51.80 kcal/mol | ||||
| first miRBase version | 3.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-30e hsa-mir-30c-1 |
||||
| Family | mir-30 (MIPF0000005) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Houbaviy et al. | Dev. Cell | 2003 | 12919684 | Embryonic stem cell-specific MicroRNAs. |
| 3 | Kasashima et al. | Biochem. Biophys. Res. Commun. | 2004 | 15325244 | Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells. |
| 4 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
| 5 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 6 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |