Precursor miRBase

hsa-mir-99b (MI0000746)

Accession MI0000746
Name hsa-mir-99b
similar to following miRCarta precursors hsa-10-151.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr19:51,692,612-51,692,681 (+)
miRNA hsa-miR-99b-5p
miRNA hsa-miR-99b-3p
Sequence (5' -> 3')
(70 nts)
GGCACCCACCCGUAGAACCGACCUUGCGGGGCCUUCGCCGCACACAAGCUCGUGUCUGUGGGUCCGUGUC
MFE -27.60 kcal/mol
first miRBase version 3.0
last miRBase version 21.0
Clusters (10 kb)
(3 precursors)
hsa-mir-99b
hsa-let-7e
hsa-mir-125a
Family mir-10 (MIPF0000033)
Experiments
experiment Pubmed link
cloned 17604727
External DBs
Gene symbol MIR99B
NCBI Gene 407056

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Houbaviy et al. Dev. Cell 2003 12919684 Embryonic stem cell-specific MicroRNAs.
3 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
4 Fu et al. FEBS Lett. 2005 15978578 Identification of human fetal liver miRNAs by a novel method.
5 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
6 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.