Precursor miRBase

hsa-mir-106b (MI0000734)

Accession MI0000734
Name hsa-mir-106b
similar to following miRCarta precursors hsa-103-87.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr7:100,093,993-100,094,074 (-)
miRNA hsa-miR-106b-5p
miRNA hsa-miR-106b-3p
Sequence (5' -> 3')
(82 nts)
CCUGCCGGGGCUAAAGUGCUGACAGUGCAGAUAGUGGUCCUCUCCGUGCUACCGCACUGUGGGUACUUGCUGCUCCAGCAGG
MFE -43.20 kcal/mol
first miRBase version 3.0
last miRBase version 21.0
Clusters (10 kb)
(3 precursors)
hsa-mir-25
hsa-mir-93
hsa-mir-106b
Family mir-17 (MIPF0000001)
Experiments
experiment Pubmed link
cloned 17604727 17616659 18230126
Northern blot 18230126
External DBs
Gene symbol MIR106B
NCBI Gene 406900

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Houbaviy et al. Dev. Cell 2003 12919684 Embryonic stem cell-specific MicroRNAs.
2 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
3 Fu et al. FEBS Lett. 2005 15978578 Identification of human fetal liver miRNAs by a novel method.
4 Cai et al. Proc. Natl. Acad. Sci. U.S.A. 2005 15800047 Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells.
5 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
6 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
7 Afanasyeva et al. BMC Genomics 2008 18230126 New miRNAs cloned from neuroblastoma.