Precursor miRBase

mmu-mir-33 (MI0000707)

Accession MI0000707
Name mmu-mir-33
similar to following miRCarta precursors mmu-257-25394.1
Organism Mus musculus
Genome GRCm38.p5
Location chr15:82,198,122-82,198,190 (+)
miRNA mmu-miR-33-5p
miRNA mmu-miR-33-3p
Sequence (5' -> 3')
(69 nts)
CUGUGGUGCAUUGUAGUUGCAUUGCAUGUUCUGGCAAUACCUGUGCAAUGUUUCCACAGUGCAUCACGG
MFE -31.40 kcal/mol
first miRBase version 3.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
mmu-mir-33
Family mir-33 (MIPF0000070)
Experiments
experiment Pubmed link
Illumina 20215419 20413612
cloned 17604727
External DBs
Gene symbol Mir33
NCBI Gene 723897

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Science 2001 11679670 Identification of novel genes coding for small expressed RNAs.
2 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
5 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.