Accession | MI0000703 | ||||
Name | mmu-mir-223 | ||||
similar to following miRCarta precursors | mmu-480-120.1 | ||||
Organism | Mus musculus | ||||
Genome | GRCm38.p5 | ||||
Location |
chrX:96,242,817-96,242,926 (+) |
||||
miRNA | mmu-miR-223-5p | ||||
miRNA | mmu-miR-223-3p | ||||
Sequence (5' -> 3') (110 nts) |
UCUGGCCAUCUGCAGUGUCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCUGUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCUCAUGCCUAUCAG | ||||
MFE | -43.10 kcal/mol | ||||
first miRBase version | 3.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
mmu-mir-223 |
||||
Family | mir-223 (MIPF0000067) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Lim et al. | Science | 2003 | 12624257 | Vertebrate microRNA genes. |
2 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |