Precursor miRBase

mmu-mir-218-1 (MI0000700)

Accession MI0000700
Name mmu-mir-218-1
similar to following miRCarta precursors mmu-24543-613.1
Organism Mus musculus
Genome GRCm38.p5
Location chr5:48,223,942-48,224,051 (+)
miRNA mmu-miR-218-5p
miRNA mmu-miR-218-1-3p
Sequence (5' -> 3')
(110 nts)
GUGAUAAUGGAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGCUUGCGAGGUAUGAGAAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA
MFE -35.90 kcal/mol
first miRBase version 3.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
mmu-mir-218-1
Family mir-218 (MIPF0000026)
Experiments
experiment Pubmed link
Illumina 20215419 20413612
cloned 17604727
External DBs
Gene symbol Mir218-1
NCBI Gene 723822

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lim et al. Science 2003 12624257 Vertebrate microRNA genes.
2 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
5 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.