Precursor miRBase

mmu-mir-212 (MI0000696)

Accession MI0000696
Name mmu-mir-212
similar to following miRCarta precursors mmu-647-330.1
Organism Mus musculus
Genome GRCm38.p5
Location chr11:75,173,388-75,173,478 (+)
miRNA mmu-miR-212-5p
miRNA mmu-miR-212-3p
Sequence (5' -> 3')
(91 nts)
GGGCAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCUUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCC
MFE -41.50 kcal/mol
first miRBase version 3.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
mmu-mir-212
mmu-mir-132
Family mir-132 (MIPF0000065)
Experiments
experiment Pubmed link
Illumina 20413612
External DBs
Gene symbol Mir212
NCBI Gene 387208

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lim et al. Science 2003 12624257 Vertebrate microRNA genes.
2 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
5 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.