| Accession | MI0000696 | ||||
| Name | mmu-mir-212 | ||||
| similar to following miRCarta precursors | mmu-647-330.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr11:75,173,388-75,173,478 (+) |
||||
| miRNA | mmu-miR-212-5p | ||||
| miRNA | mmu-miR-212-3p | ||||
| Sequence (5' -> 3') (91 nts) |
GGGCAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCUUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCC | ||||
| MFE | -41.50 kcal/mol | ||||
| first miRBase version | 3.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
mmu-mir-212 mmu-mir-132 |
||||
| Family | mir-132 (MIPF0000065) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lim et al. | Science | 2003 | 12624257 | Vertebrate microRNA genes. |
| 2 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |