Precursor miRBase

rno-mir-151 (MI0000647)

Accession MI0000647
Name rno-mir-151
similar to following miRCarta precursors rno-75-25371.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr7:114,421,107-114,421,203 (-)
miRNA rno-miR-151-5p
miRNA rno-miR-151-3p
Sequence (5' -> 3')
(97 nts)
AGCGCUUUCCUGCCCUCGAGGAGCUCACAGUCUAGUAUGUCUCCUCCCUACUAGACUGAGGCUCCUUGAGGACAGGGAUCGUCAUACUCACCUCCCG
MFE -47.10 kcal/mol
first miRBase version 3.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
rno-mir-3586
rno-mir-151
Family mir-28 (MIPF0000057)
Experiments
experiment Pubmed link
cloned 17604727
SOLiD 20403161
External DBs
Gene symbol Mir151
NCBI Gene 100314223

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
2 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.