| Accession | MI0000615 | ||||||
| Name | mmu-mir-337 | ||||||
| similar to following miRCarta precursors | mmu-25191-25190.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr12:109,585,789-109,585,885 (+) |
||||||
| miRNA | mmu-miR-337-5p | ||||||
| miRNA | mmu-miR-337-3p | ||||||
| Sequence (5' -> 3') (97 nts) |
CAGUGUAGUGAGAAGUUGGGGGGUGGGAACGGCGUCAUGCAGGAGUUGAUUGCACAGCCAUUCAGCUCCUAUAUGAUGCCUUUCUUCACCCCCUUCA | ||||||
| MFE | -49.40 kcal/mol | ||||||
| first miRBase version | 3.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (14 precursors) |
mmu-mir-493
mmu-mir-337 mmu-mir-3544 mmu-mir-540 mmu-mir-665 mmu-mir-3070-1 mmu-mir-3070-2 mmu-mir-431 mmu-mir-433 mmu-mir-127 mmu-mir-434 mmu-mir-432 mmu-mir-3071 mmu-mir-136 |
||||||
| Family | mir-337 (MIPF0000195) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Kim et al. | Proc. Natl. Acad. Sci. U.S.A. | 2004 | 14691248 | Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. |
| 2 | Seitz et al. | Genome Res. | 2004 | 15310658 | A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |