| Accession | MI0000601 | ||||||||
| Name | rno-let-7d | ||||||||
| similar to following miRCarta precursors | rno-90-98.1 | ||||||||
| potential naming conflicts with | rno-let-7d-5p (MIMAT0000562) | ||||||||
| Organism | Rattus norvegicus | ||||||||
| Genome | Rnor_5.0 | ||||||||
| Location |
chr17:18,476,093-18,476,190 (+) |
||||||||
| miRNA | rno-let-7d-5p | ||||||||
| miRNA | rno-let-7d-3p | ||||||||
| Sequence (5' -> 3') (98 nts) |
UGGGCUCCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGAGAUUUUGCCCACAAGGAGUUAACUAUACGACCUGCUGCCUUUCUUAGGGCCUU | ||||||||
| MFE | -51.60 kcal/mol | ||||||||
| first miRBase version | 3.0 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (5 precursors) |
rno-let-7a-1
rno-mir-3596d rno-let-7f-1 rno-let-7d rno-mir-3596b |
||||||||
| Family | let-7 (MIPF0000002) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Miska et al. | Genome Biol. | 2004 | 15345052 | Microarray analysis of microRNA expression in the developing mammalian brain. |
| 2 | Kim et al. | Proc. Natl. Acad. Sci. U.S.A. | 2004 | 14691248 | Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. |
| 3 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |