| Accession | MI0000683 | ||||
| Name | hsa-mir-181b-2 | ||||
| similar to following miRCarta precursors | hsa-72-488.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr9:124,693,710-124,693,798 (+) |
||||
| miRNA | hsa-miR-181b-5p | ||||
| miRNA | hsa-miR-181b-2-3p | ||||
| Sequence (5' -> 3') (89 nts) |
CUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGAGUCUGAAUCAACUCACUGAUCAAUGAAUGCAAACUGCGGACCAAACA | ||||
| MFE | -34.70 kcal/mol | ||||
| first miRBase version | 3.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-181a-2
hsa-mir-181b-2 |
||||
| Family | mir-181 (MIPF0000007) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lim et al. | Science | 2003 | 12624257 | Vertebrate microRNA genes. |
| 2 | Cai et al. | Proc. Natl. Acad. Sci. U.S.A. | 2005 | 15800047 | Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells. |
| 3 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
| 4 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |