Accession | MI0000736 | ||||
Name | hsa-mir-30c-1 | ||||
similar to following miRCarta precursors | hsa-57-456.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr1:40,757,284-40,757,372 (+) |
||||
miRNA | hsa-miR-30c-5p | ||||
miRNA | hsa-miR-30c-1-3p | ||||
Sequence (5' -> 3') (89 nts) |
ACCAUGCUGUAGUGUGUGUAAACAUCCUACACUCUCAGCUGUGAGCUCAAGGUGGCUGGGAGAGGGUUGUUUACUCCUUCUGCCAUGGA | ||||
MFE | -34.30 kcal/mol | ||||
first miRBase version | 3.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
hsa-mir-30e
hsa-mir-30c-1 |
||||
Family | mir-30 (MIPF0000005) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
2 | Kasashima et al. | Biochem. Biophys. Res. Commun. | 2004 | 15325244 | Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells. |
3 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
4 | Fu et al. | FEBS Lett. | 2005 | 15978578 | Identification of human fetal liver miRNAs by a novel method. |
5 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
6 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |