Precursor miRBase

mmu-mir-199a-2 (MI0000713)

Accession MI0000713
Name mmu-mir-199a-2
similar to following miRCarta precursors mmu-86-46.1
Organism Mus musculus
Genome GRCm38.p5
Location chr1:162,217,814-162,217,923 (+)
miRNA mmu-miR-199a-5p
miRNA mmu-miR-199a-3p
Sequence (5' -> 3')
(110 nts)
UGGAAGCUUCAGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGCCAGCA
MFE -42.50 kcal/mol
first miRBase version 3.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
mmu-mir-199a-2
mmu-mir-214
Family mir-199 (MIPF0000040)
Experiments
experiment Pubmed link
Illumina 20215419 20413612
cloned 17604727 12554859
External DBs
Gene symbol Mir199a-2
NCBI Gene 723821

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lim et al. Science 2003 12624257 Vertebrate microRNA genes.
2 Houbaviy et al. Dev. Cell 2003 12919684 Embryonic stem cell-specific MicroRNAs.
3 Lagos-Quintana et al. RNA 2003 12554859 New microRNAs from mouse and human.
4 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
5 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
6 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
7 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.