Precursor miRBase

mmu-mir-29b-2 (MI0000712)

Accession MI0000712
Name mmu-mir-29b-2
similar to following miRCarta precursors mmu-239-81.1
Organism Mus musculus
Genome GRCm38.p5
Location chr1:195,037,040-195,037,120 (+)
miRNA mmu-miR-29b-2-5p
miRNA mmu-miR-29b-3p
Sequence (5' -> 3')
(81 nts)
CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG
MFE -31.10 kcal/mol
first miRBase version 3.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
mmu-mir-29b-2
mmu-mir-29c
Family mir-29 (MIPF0000009)
Experiments
experiment Pubmed link
Illumina 20413612
454 20668074
External DBs
Gene symbol Mir29b-2
NCBI Gene 723963

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Houbaviy et al. Dev. Cell 2003 12919684 Embryonic stem cell-specific MicroRNAs.
3 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
4 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
5 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
6 Zhu et al. J. Virol. 2010 20668074 Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68.
7 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
8 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.