Accession | MI0000588 | ||||||
Name | mmu-mir-103-2 | ||||||
similar to following miRCarta precursors | mmu-481-12.1 | ||||||
Organism | Mus musculus | ||||||
Genome | GRCm38.p5 | ||||||
Location |
chr2:131,288,052-131,288,137 (+) |
||||||
miRNA | mmu-miR-103-2-5p | ||||||
miRNA | mmu-miR-103-3p | ||||||
Sequence (5' -> 3') (86 nts) |
GUCUUCGUGCUUUCAGCUUCUUUACAGUGCUGCCUUGUAGCAUUCAGGUCAAGCAGCAUUGUACAGGGCUAUGAAAGAACCAAGAA | ||||||
MFE | -31.50 kcal/mol | ||||||
first miRBase version | 2.2 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (1 precursors) |
mmu-mir-103-2 |
||||||
Family | mir-103 (MIPF0000024) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Mourelatos et al. | Genes Dev. | 2002 | 11914277 | miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. |
2 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
3 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
5 | Zhu et al. | J. Virol. | 2010 | 20668074 | Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68. |
6 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
7 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |