Precursor miRBase

mmu-mir-103-1 (MI0000587)

Accession MI0000587
Name mmu-mir-103-1
similar to following miRCarta precursors mmu-2698-13.1
Organism Mus musculus
Genome GRCm38.p5
Location chr11:35,782,396-35,782,481 (+)
miRNA mmu-miR-103-1-5p
miRNA mmu-miR-103-3p
Sequence (5' -> 3')
(86 nts)
UUCUUACUGCCCUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUACAGGGCUAUGAAGGCAUUGAGAC
MFE -34.20 kcal/mol
first miRBase version 2.2
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
mmu-mir-103-1
Family mir-103 (MIPF0000024)
Experiments
experiment Pubmed link
Illumina 20413612
454 20668074
External DBs
Gene symbol Mir103-1
NCBI Gene 723824

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Mourelatos et al. Genes Dev. 2002 11914277 miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs.
2 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
3 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Zhu et al. J. Virol. 2010 20668074 Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68.
6 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
7 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.