Precursor miRBase

mmu-mir-26a-1 (MI0000573)

Accession MI0000573
Name mmu-mir-26a-1
similar to following miRCarta precursors mmu-34-546.1
Organism Mus musculus
Genome GRCm38.p5
Location chr9:119,031,796-119,031,885 (+)
miRNA mmu-miR-26a-5p
miRNA mmu-miR-26a-1-3p
Sequence (5' -> 3')
(90 nts)
AAGGCCGUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAGGGGCCUAUUCUUGGUUACUUGCACGGGGACGCGGGCCUG
MFE -48.60 kcal/mol
first miRBase version 2.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
mmu-mir-26a-1
Family mir-26 (MIPF0000043)
Experiments
experiment Pubmed link
Illumina 20413612
External DBs
Gene symbol Mir26a-1
NCBI Gene 387218

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
3 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
6 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.